This is me, swanning off
Look, it’s my new shoulder tattoo!
It’s sort of the classic DNA molecule, splitting off into a structural representation of the sugar-phosphate backbone, with the nucleotide sequence:
5’ - TTTGCTATTACTCATATTTCTAATACTGCTGTTATTCGTACTTGAGAA - 3’
Each set of three base pairs can be translated into an amino acid, which is then represented by a single letter, so my tattoo spells:
FAITHISNTAVIRTUE

Look, it’s my new shoulder tattoo!

It’s sort of the classic DNA molecule, splitting off into a structural representation of the sugar-phosphate backbone, with the nucleotide sequence:

5’ - TTTGCTATTACTCATATTTCTAATACTGCTGTTATTCGTACTTGAGAA - 3’

Each set of three base pairs can be translated into an amino acid, which is then represented by a single letter, so my tattoo spells:

FAITHISNTAVIRTUE

  1. come-on-an-adventure-with-me reblogged this from takma-rierah
  2. chileanboyvstheworld reblogged this from einsamkeit33
  3. einsamkeit33 reblogged this from takma-rierah
  4. eclecticpulse reblogged this from scienceshenanigans
  5. scienceshenanigans reblogged this from surviving-science
  6. callstheadventurescience reblogged this from surviving-science
  7. futuredoctorsandcoffee reblogged this from surviving-science
  8. unknownwind reblogged this from surviving-science
  9. whatstopsyouhere reblogged this from takma-rierah
  10. aliquot reblogged this from surviving-science
  11. skinofalion reblogged this from takma-rierah and added:
    Fecking. Awesome. I wanted to do something similar. God-damn I love science.
  12. shinkigami reblogged this from surviving-science
  13. howinternet reblogged this from blue-death
  14. slytherindoctorsat221b reblogged this from blue-death
  15. metirealvacioynomerompi reblogged this from blue-death
  16. blue-death reblogged this from takma-rierah and added:
    la huea hermosa por la csm ;_;
  17. mind-evolution reblogged this from takma-rierah and added:
    Awesome. You win.
  18. igotswagger247 reblogged this from surviving-science
  19. elizgrace reblogged this from takma-rierah
  20. sirdreamalot reblogged this from surviving-science
  21. widerskiesofblue reblogged this from takma-rierah
  22. delenas-bourbon reblogged this from kitsuune
  23. kitsuune reblogged this from surviving-science and added:
    this is fucking genius.
  24. thevillagewitch reblogged this from thoughtsofametalnerd
  25. irreverentideas reblogged this from takma-rierah
  26. zodiacsam reblogged this from plaguesandpuppies
  27. thoughtsofametalnerd reblogged this from surviving-science and added:
    You are my idol. :D
  28. smokeandsignalflares reblogged this from takma-rierah