This is me, swanning off
Look, it’s my new shoulder tattoo!
It’s sort of the classic DNA molecule, splitting off into a structural representation of the sugar-phosphate backbone, with the nucleotide sequence:
5’ - TTTGCTATTACTCATATTTCTAATACTGCTGTTATTCGTACTTGAGAA - 3’
Each set of three base pairs can be translated into an amino acid, which is then represented by a single letter, so my tattoo spells:
FAITHISNTAVIRTUE

Look, it’s my new shoulder tattoo!

It’s sort of the classic DNA molecule, splitting off into a structural representation of the sugar-phosphate backbone, with the nucleotide sequence:

5’ - TTTGCTATTACTCATATTTCTAATACTGCTGTTATTCGTACTTGAGAA - 3’

Each set of three base pairs can be translated into an amino acid, which is then represented by a single letter, so my tattoo spells:

FAITHISNTAVIRTUE

  1. come-on-an-adventure-with-me reblogged this from takma-rierah
  2. charyl-silva reblogged this from takma-rierah
  3. chileanboyvstheworld reblogged this from einsamkeit33
  4. einsamkeit33 reblogged this from takma-rierah
  5. eclecticpulse reblogged this from scienceshenanigans
  6. scienceshenanigans reblogged this from surviving-science
  7. callstheadventurescience reblogged this from surviving-science
  8. futuredoctorsandcoffee reblogged this from surviving-science
  9. unknownwind reblogged this from surviving-science
  10. artisticdeuxyribose reblogged this from takma-rierah and added:
    thats a fancy way of coding a phrase i like it
  11. whatstopsyouhere reblogged this from takma-rierah
  12. aliquot reblogged this from surviving-science
  13. skinofalion reblogged this from takma-rierah and added:
    Fecking. Awesome. I wanted to do something similar. God-damn I love science.
  14. shinkigami reblogged this from surviving-science
  15. howinternet reblogged this from blue-death
  16. slytherindoctorsat221b reblogged this from blue-death
  17. metirealvacioynomerompi reblogged this from blue-death
  18. blue-death reblogged this from takma-rierah and added:
    la huea hermosa por la csm ;_;
  19. mind-evolution reblogged this from takma-rierah and added:
    Awesome. You win.
  20. igotswagger247 reblogged this from surviving-science
  21. elizgrace reblogged this from takma-rierah
  22. sirdreamalot reblogged this from surviving-science
  23. widerskiesofblue reblogged this from takma-rierah
  24. delenas-bourbon reblogged this from kitsuune
  25. kitsuune reblogged this from surviving-science and added:
    this is fucking genius.
  26. thevillagewitch reblogged this from thoughtsofametalnerd
  27. irreverentideas reblogged this from takma-rierah
  28. zodiacsam reblogged this from plaguesandpuppies
  29. thoughtsofametalnerd reblogged this from surviving-science and added:
    You are my idol. :D
  30. smokeandsignalflares reblogged this from takma-rierah